SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


lactate catabolic enzyme
53.31 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
lactate utilization
lactate oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,493,519 3,494,958

    Phenotypes of a mutant

  • no growth with lactate as the single carbon source [Pubmed|19201793]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of lactate to pyruvate [Pubmed|19201793]
  • Protein family

  • LutB/YkgF family (single member, according to UniProt)
  • [SW|Domains]

  • 2 [SW|4Fe-4S ferredoxin-type domain]s (aa 304-334, aa 353-382) (according to UniProt)
  • Modification

  • phosphorylated on Arg-33 [Pubmed|22517742]
  • [SW|Cofactors]

  • FeS cluster
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19201793], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: repression, in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • induction by lactate [Pubmed|19201793]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|22427629,18697947]
  • [protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|FbpB]: translation inhibition, acts as RNA chaperone, increases interaction between [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA] and [protein|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|LutA]-[protein|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|LutB]-[protein|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|LutC] RNAs
  • Biological materials


  • MGNA-A498 (yvfW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34040 ([gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCTTTCCCCCTCTG, downstream forward: _UP4_GAACGCACGAAGGAGGAGCA
  • BKK34040 ([gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCTTTCCCCCTCTG, downstream forward: _UP4_GAACGCACGAAGGAGGAGCA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References

  • 22427629,18697947,16430695,22389480,19201793,19201793,22517742