SubtiBank SubtiBank
comC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comC

late competence gene required for processing and translocation of ComGC, ComGD, ComGE and ComGG
locus
BSU_28070
pI
9.84
mw
26.37 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
genetic competence
product
processing protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,864,426 2,865,172

    The protein

    Catalyzed reaction/ biological activity

  • processing and translocation of [protein|19D76B80386F825109C5FB4A34881D5D20F366DB|ComGC], [protein|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|ComGD], [protein|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|ComGE] and [protein|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|ComGG] [Pubmed|9723928]
  • Typically cleaves a -Gly-|-Phe- bond to release an N-terminal, basic peptide of 5-8 residues from type IV prepilin, and then N-methylates the new N-terminal amino group, the methyl donor being S-adenosyl-L-methionine (according to UniProt)
  • Protein family

  • peptidase A24 family (single member, according to UniProt)
  • [SW|Localization]

  • integral membrane protein [Pubmed|24164455]
  • Expression and Regulation

    Operons

    genes
    [gene|57FDE2ABB5E9773717C23D727FD6CDA5D8CC3E36|comC]
    description
    [Pubmed|1694528]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1694528], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE28070 ([gene|57FDE2ABB5E9773717C23D727FD6CDA5D8CC3E36|comC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGACAACACACCTTTAC, downstream forward: _UP4_TGACTGCTGAAAAATTTGAC
  • BKK28070 ([gene|57FDE2ABB5E9773717C23D727FD6CDA5D8CC3E36|comC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGACAACACACCTTTAC, downstream forward: _UP4_TGACTGCTGAAAAATTTGAC
  • References

    Reviews

  • 15083159
  • Original publications

  • 9723928,16751195,7783624,2553669,1694528,8196543,24164455