SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|RNA polymerase] [SW|sigma factor] SigB
29.99 kDa
protein length
264 aa Sequence Blast
gene length
792 bp Sequence Blast
general stress response
[SW|RNA polymerase] [SW|sigma factor] SigB

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    522,862 → 523,650

    The protein

    Protein family

  • SigB subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|1L0O] ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]-[protein|search|SpoIIAB ]complex from Geobacillus stearothermophilus, 32% identity) [pubmed|11955433]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab



  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • QB5344 (cat), available in the [SW|Stülke] lab
  • 1A675 ( ''sigB''::''cat''), [Pubmed|3027048], available at [ BGSC]
  • 1A777 ( ''sigB''::''cat''), [Pubmed|1744042], available at [ BGSC]
  • 1A780 ( ''sigB''::''spec''), [Pubmed|8253681], available at [ BGSC]
  • BKE04730 (Δ[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTATGAGCCGATCGACTT, downstream forward: _UP4_GATCCCTCGATGGAGTTAAT
  • BKK04730 (Δ[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTTATGAGCCGATCGACTT, downstream forward: _UP4_GATCCCTCGATGGAGTTAAT
  • Labs working on this gene/protein

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [ homepage]
  • References


  • 19575568,18035607,11407115,9767581,20658979,27518094,28271471
  • Control of SigB activity by protein-protein interactions

  • 11377871,12270815,15312768,8460143,8682769,8002610,11591687,7601843,17498739,15342582
  • Identification of the SigB regulon

  • 11544224,11532142,11717291,10482513,10220166,22174379
  • Other publications

  • 23407164,22511268,22210769,23524614,21979936,8655572,3123466,10369900,3112122,8468294,8458834,13129942,6784117,12867438,3100810,8253681,12486038,8764398,3027048,15342585,17575448,17586624,23934352,25652417,3016731,11902719,14651641,10503549,15205443,6405278,10383961,15805528,6790515,116131,39767581,19948797,22582280,24572018,24878601,27977677,28461450,11955433,28727759,29454936,30396900