SubtiBank SubtiBank
melR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

melR

transcriptional regulator of the [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] operon
locus
BSU_30260
pI
6.45
mw
38.24 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
regulation of melibiose utilization
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
msmR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,096,782 3,097,816

    The protein

    Catalyzed reaction/ biological activity

  • represses the the [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] operon in the absence of melibiose or raffinose [pubmed|31138628]
  • Protein family

  • [SW|LacI family]
  • Structure

  • [PDB|1VPW] (E. coli [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR], 29% identity) [pubmed|9628480]
  • Expression and Regulation

    Operons

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A802 (msmR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/802 NBRP B. subtilis, Japan]
  • BKE30260 ([gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCCCTCTCATCT, downstream forward: _UP4_TAAGCAAAGATTCATCACGA
  • BKK30260 ([gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATCCCTCTCATCT, downstream forward: _UP4_TAAGCAAAGATTCATCACGA
  • References

  • 22383849,22900538,9628480,31138628