SubtiBank SubtiBank
mdh
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mdh

malate dehydrogenase
locus
BSU29120
pI
4.73
mw
33.49 kDa
protein length
312 aa Sequence Blast
gene length
939 bp Sequence Blast
function
TCA cycle
product
malate dehydrogenase
essential
no
ec
1.1.1.37
synonyms
citH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,978,734 2,979,672

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ = oxaloacetate + NADH (according to Swiss-Prot)
  • Protein family

  • MDH type 3 family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-156 [Pubmed|22517742]
  • phosphorylation on Ser-149 [Pubmed|17218307]
  • [SW|Cofactors]

  • NAD+
  • Effectors of protein activity

  • Inhibited by Mg2+, Ca2+, Zn2+, Ag2+ and Hg2+ [Pubmed|14284712] [Pubmed|922015]
  • Inhibited by oxaloacetate (above 1mM) and malate (above 7,7mM) [Pubmed|14284712]
  • Structure

  • [PDB|3TL2] (from ''B. anthracis'', 85% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • membrane associated [Pubmed|18763711]
  • Additional information

  • The enzyme is a tetramer [Pubmed|14284712]
  • extensive information on the structure and enzymatic properties of Mdh can be found at [http://www.proteopedia.org/wiki/index.php/Malate_dehydrogenase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
    description
    [Pubmed|8045899]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • regulation

  • ''[protein|search|citZ]'': catabolite repression ([protein|search|CcpA]) [Pubmed|12100558]
  • view in new tab

    genes
    [gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
    description
    [Pubmed|8045899]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA destabilization, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • ''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12100558]
  • view in new tab

    Biological materials

    Mutant

  • GP719(spc) & GP1150(spc), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • GP790 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [SW|Jörg Stülke]'s lab
  • GP2331 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [SW|Jörg Stülke]'s lab
  • GP2333 Δ(''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE29120 ([gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTTCTCCTTTA, downstream forward: _UP4_TAATAAAAAGAGAGAAAGGC
  • BKK29120 ([gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTTCTCCTTTA, downstream forward: _UP4_TAATAAAAAGAGAGAAAGGC
  • Expression vectors

  • pGP385: for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab
  • pGP1123 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • pGP1755 (expression / purification of Mdh-S149A, with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP1764 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
  • GP1438(''mdh''-''Strep'' ''(spc)'') & GP1440(''mdh''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1431 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1130 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • Antibody

  • **
  • References

  • 10656796,18763711,14284712,922015,12100558,17218307,8550482,8045899,20933603,22517742,23136871,24325460,15378759,24571712,29546354