SubtiBank SubtiBank
yesT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yesT

rhamnogalacturonan acetylesterase
locus
BSU_07020
pI
5.51
mw
25.80 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
function
pectin utilization
product
rhamnogalacturonan esterase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    768,137 768,835

    The protein

    Protein family

  • [SW|'GDSL' lipolytic enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D2790591E8C3B86BF91F6E1B6DADBA306D5EF758|YxiM], [protein|578B79EB64B804FCAACA73AB22458481371A815C|YesY]
  • Structure

  • [PDB|2O14] ([protein|D2790591E8C3B86BF91F6E1B6DADBA306D5EF758|YxiM], 29% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
    description
    [Pubmed|19651770]

    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B451 (yesT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1450 NBRP B. subtilis, Japan]
  • BKE07020 ([gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTCATCACATGTTCTC, downstream forward: _UP4_CTTGTGAGCCGGGAGGGAAA
  • BKK07020 ([gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTTCATCACATGTTCTC, downstream forward: _UP4_CTTGTGAGCCGGGAGGGAAA
  • References

  • 19651770,17957779,17449691