SubtiBank SubtiBank
bioB

bioB

biotin synthase
locus
BSU_30200
pI
5.55
mw
36.77 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
function
biosynthesis of biotin
product
biotin synthase
essential
no
ec
2.8.1.6
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.1|Biosynthesis/ acquisition of biotin]
  • The protein

    Catalyzed reaction/ biological activity

  • [sulfur carrier]-SH + dethiobiotin + 2 reduced [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> 2 5'-deoxyadenosine + [sulfur carrier]-H + biotin + 2 L-methionine + 2 oxidized [2Fe-2S]-[ferredoxin] (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1R30] (from ''E. coli'', 36% identity) [Pubmed|14704425]
  • Expression and Regulation

    Operons

    genes
    [gene|C40116089BAD3F9831F8C837DC4F2E045753ABDE|bioW]-[gene|68C86FED3575B864C576DFB73FE7B5BF83994D1F|bioA]-[gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]-[gene|D9A71DAF949FB6C9C22C8361D83C5A0741184977|bioD]-[gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]-[gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]-[gene|089A32D08B5A7E552CBD9CB9745BD542863B4558|ytbQ]
    description
    [Pubmed|8763940,8892842]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials

    Mutant

  • BKE30200 ([gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTTCCATCCATTGATTCA, downstream forward: _UP4_TGAAAGAATCAATAAAAGCA
  • BKK30200 ([gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTTCCATCCATTGATTCA, downstream forward: _UP4_TGAAAGAATCAATAAAAGCA
  • References

  • 14704425,8763940,8892842