SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


biotin synthase
36.77 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
biosynthesis of biotin
biotin synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • The protein

    Catalyzed reaction/ biological activity

  • [sulfur carrier]-SH + dethiobiotin + 2 reduced [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> 2 5'-deoxyadenosine + [sulfur carrier]-H + biotin + 2 L-methionine + 2 oxidized [2Fe-2S]-[ferredoxin] (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1R30] (from ''E. coli'', 36% identity) [Pubmed|14704425]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • BKE30200 ([gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTTCCATCCATTGATTCA, downstream forward: _UP4_TGAAAGAATCAATAAAAGCA
  • BKK30200 ([gene|5880617EB95FC0D19219A868D6D0A3D1D0D9C532|bioB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGTTCCATCCATTGATTCA, downstream forward: _UP4_TGAAAGAATCAATAAAAGCA
  • References

  • 14704425,8763940,8892842