SubtiBank SubtiBank
skfE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

skfE

[SW|ABC transporter] (binding protein), export of the spore killing factor
locus
BSU_01950
pI
6.34
mw
26.75 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
function
export of the spore killing factor [protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA]
product
[SW|ABC transporter] (binding protein)
essential
no
ec
3.6.3.25
synonyms
ybdA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    216,913 217,632

    Phenotypes of a mutant

  • inactivation of ''[gene|5886364199844356446C08F08664B301A714E74A|skfE]'' reduces sporulation efficiency to 54% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + sulfate --> ADP + H+ + phosphate + sulfate (according to UniProt)
  • ATP + H2O + thiosulfate --> ADP + H+ + phosphate + thiosulfate (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-232) (according to UniProt)
  • Structure

  • [PDB|4RVC] (from Geobacillus kaustophilus, 33% identity) [pubmed|25724946]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]
    description
    [Pubmed|16816204]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|search|skfA]'-specific transcript, and a weaker 6.5 kb '[protein|search|skfA]-[protein|search|skfB]-[protein|search|skfC]-[protein|search|skfE]-[protein|search|skfF]-[protein|search|skfG]-[protein|search|skfH]' transcript.
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C515 (ybdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2513 NBRP B. subtilis, Japan]
  • BKE01950 ([gene|5886364199844356446C08F08664B301A714E74A|skfE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCATCAAATCTTCTCCTA, downstream forward: _UP4_TAATATCATTTCTTTTTTAT
  • BKK01950 ([gene|5886364199844356446C08F08664B301A714E74A|skfE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCATCAAATCTTCTCCTA, downstream forward: _UP4_TAATATCATTTCTTTTTTAT
  • References

    Reviews

  • 20955377
  • Original Publications

  • 11731129,10092453,12817086,16816204,14651647,15687200,15687200,17720793,17449691,18840696,26735940,25724946