SubtiBank SubtiBank
fisB
The papers of the month are back! Check them out! Link here

fisB

membrane fission protein, mediates membrane fission during sporulation
locus
BSU32350
pI
9.53
mw
27.76 kDa
protein length
254 aa Sequence Blast
gene length
762 bp Sequence Blast
function
release of the forespore into the mother cell cytoplasm
product
membrane fission protein
essential
no
synonyms
yunB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,322,463 → 3,323,227

    Phenotypes of a mutant

  • reduced sporulation efficiency (12 - 15%) [Pubmed|23388828]
  • The protein

    Catalyzed reaction/ biological activity

  • mediates membrane fission during [SW|sporulation] [Pubmed|23388828]
  • binds cardiolipin [Pubmed|23388828]
  • [SW|Localization]

  • cell membrane [Pubmed|23388828]
  • forms dynamic foci which become immobilized at the site of membrane fission [Pubmed|23388828]
  • Expression and Regulation

    Operons

    genes
    [gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A978 (yunB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/978 NBRP B. subtilis, Japan]
  • BKE32350 (Δ[gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATCCCCCCTTACA, downstream forward: _UP4_TAAGCCGCCTGTTGAAGAGG
  • BKK32350 (Δ[gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATCCCCCCTTACA, downstream forward: _UP4_TAAGCCGCCTGTTGAAGAGG
  • References

    Reviews

  • 23518060
  • Original publications

  • 12662922,15699190,23388828