SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane fission protein, mediates membrane fission during sporulation
27.76 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
release of the forespore into the mother cell cytoplasm
membrane fission protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,322,463 3,323,227

    Phenotypes of a mutant

  • reduced sporulation efficiency (12 - 15%) [Pubmed|23388828]
  • The protein

    Catalyzed reaction/ biological activity

  • mediates membrane fission during [SW|sporulation] [Pubmed|23388828]
  • binds cardiolipin [Pubmed|23388828]
  • [SW|Localization]

  • cell membrane [Pubmed|23388828]
  • forms dynamic foci which become immobilized at the site of membrane fission [Pubmed|23388828]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials


  • MGNA-A978 (yunB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32350 ([gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATCCCCCCTTACA, downstream forward: _UP4_TAAGCCGCCTGTTGAAGAGG
  • BKK32350 ([gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATCCCCCCTTACA, downstream forward: _UP4_TAAGCCGCCTGTTGAAGAGG
  • References


  • 23518060
  • Original publications

  • 12662922,15699190,23388828