SubtiBank SubtiBank
cysP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cysP

sulfate transport in via proton symport
locus
BSU_15580
pI
10.27
mw
36.68 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
sulfate uptake
product
sulfate transport in via proton symport
essential
no
synonyms
ylnA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,631,095 1,632,159

    The protein

    Protein family

  • inorganic phosphate transporter (PiT) (TC 2.A.20) family (with [protein|BBFA6A5EE16CE6203AF89573F87678395277C9E8|Pit], according to UniProt)
  • [SW|Localization]

  • cell membrane
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B365 (ylnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1364 NBRP B. subtilis, Japan]
  • BKE15580 ([gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTAATTCCATTTTGCAGC, downstream forward: _UP4_TGATCATTAATCTGAGTAAT
  • BKK15580 ([gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTAATTCCATTTTGCAGC, downstream forward: _UP4_TGATCATTAATCTGAGTAAT
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 16267287,18039762,12107147