SubtiBank SubtiBank
ybaR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybaR

fumarate transporter
locus
BSU_01580
pI
7.90
mw
51.01 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
function
uptake of fumarate
product
fumarate:proton symporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    177,083 178,519

    The protein

    Protein family

  • SLC26A/SulP transporter (TC 2.A.53) family (with [protein|7028580E25DD6C1D49A14F29DDCC02012F94FED7|YvdB], according to UniProt)
  • [SW|Domains]

  • [SW|STAS domain] (aa 389-478) (according to UniProt)
  • Structure

  • [PDB|5DA0] (from ''Deinococcus radiodurans'', 63% identity) [Pubmed|26367249]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B948 (ybaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1947 NBRP B. subtilis, Japan]
  • BKE01580 ([gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACGACTCCTTTT, downstream forward: _UP4_TAAAATAGAGAAGCCCAGAT
  • BKK01580 ([gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACGACTCCTTTT, downstream forward: _UP4_TAAAATAGAGAAGCCCAGAT
  • References

  • 26367249