SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


3-dehydroquinate synthase
40.66 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast
biosynthesis of aromatic amino acids
3-dehydroquinate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,378,012 2,379,100

    The protein

    Catalyzed reaction/ biological activity

  • 7-phospho-2-dehydro-3-deoxy-D-arabino-heptonate --> 3-dehydroquinate + phosphate (according to UniProt)
  • Protein family

  • sugar phosphate cyclases superfamily (single member, according to UniProt)
  • Structure

  • [PDB|3CLH] (from ''Helicobacter pylori'', 36% identity) [Pubmed|18503755]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • 1A613 ( ''aroB''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE22700 ([gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_AGTTTGAACATGCAGTGTCT, downstream forward: _UP4_AAATGGCGATTGGAGGAGAC
  • BKK22700 ([gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTTGAACATGCAGTGTCT, downstream forward: _UP4_AAATGGCGATTGGAGGAGAC
  • References


  • 12966138
  • Original publications

  • 4200844,18503755,21815947,28516784