SubtiBank SubtiBank
gcvH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gcvH

glycine cleavage system protein H, lipoyl-binding site, octanoyltransferase for lipoic acid biosynthesis, required for lipoate transfer to 2-oxo acid dehydrogenases
locus
BSU_32800
pI
3.89
mw
14.11 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
glycine utilization
product
glycine cleavage system protein H
essential
no
synonyms
yusH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.7|Biosynthesis and scavenging of lipoic acid]
  • Gene

    Coordinates
    3,366,123 3,366,506

    The protein

    Catalyzed reaction/ biological activity

  • degradation of glycine. [protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH] shuttles the methylamine group of glycine from [protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|GcvPB] to [protein|F6F449170276055E6D60D89E9E17A152A82CA166|GcvT] (according to UniProt)
  • assembly of lipoate, and transfer of the cofactor to [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC], and [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB]
  • Protein family

  • gcvH family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|Lipoyl-binding domain] (aa 22-104) (according to UniProt)
  • [SW|Cofactors]

  • lipoic acid (on Lys-63), lipoylated by [protein|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|LipM] [Pubmed|20882995], can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN] [pubmed|28900027]
  • Structure

  • [PDB|3IFT] (from ''Mycobacterium tuberculosis'', 50% identity) [Pubmed|20364333]
  • Expression and Regulation

    Operons

    genes
    [gene|5278DD377B110CC14E239B9428F1985B472EEDF5|yusI]-[gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]-[gene|0253D9B030630340551DC2D4F40B3B118DB0EC56|yusG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B592 (yusH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1591 NBRP B. subtilis, Japan]
  • BKE32800 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAATCCCTCCATTTT, downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
  • BKK32800 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAATCCCTCCATTTT, downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
  • GP2585 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • Expression vector

  • pGP2328: in [SW|pBQ200], for expression in B. subtilis, available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 27074917
  • Original publications

  • 20882995,21338421,20364333,28900027,29339506,31066113