SubtiBank SubtiBank


glycine cleavage system protein H, lipoyl-binding site, octanoyltransferase for lipoic acid biosynthesis, required for lipoate transfer to 2-oxo acid dehydrogenases
14.11 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
glycine utilization
glycine cleavage system protein H

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of threonine/ glycine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis and scavenging of lipoic acid]
  • Gene

    3,366,123 3,366,506

    The protein

    Catalyzed reaction/ biological activity

  • degradation of glycine. [protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH] shuttles the methylamine group of glycine from [protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|GcvPB] to [protein|F6F449170276055E6D60D89E9E17A152A82CA166|GcvT] (according to UniProt)
  • assembly of lipoate, and transfer of the cofactor to [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC], and [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB]
  • Protein family

  • gcvH family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|Lipoyl-binding domain] (aa 22-104) (according to UniProt)
  • [SW|Cofactors]

  • lipoic acid (on Lys-63), lipoylated by [protein|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|LipM] [Pubmed|20882995], can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN] [pubmed|28900027]
  • Structure

  • [PDB|3IFT] (from ''Mycobacterium tuberculosis'', 50% identity) [Pubmed|20364333]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B592 (yusH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32800 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAATCCCTCCATTTT, downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
  • BKK32800 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAATCCCTCCATTTT, downstream forward: _UP4_TAAAACAGGATAGCCGTAAA
  • GP2585 ([gene|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|gcvH]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References


  • 27074917
  • Original publications

  • 20882995,21338421,20364333,28900027,29339506,31066113