SubtiBank SubtiBank
citZ
The papers of the month are back! Check them out! Link here

citZ

citrate synthase
locus
BSU29140
pI
5.45
mw
41.57 kDa
protein length
372 aa Sequence Blast
gene length
1116 bp Sequence Blast
function
TCA cycle
product
citrate synthase II
essential
no
ec
2.3.3.1
synonyms
citA2

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,981,151 → 2,982,269

    Phenotypes of a mutant

  • glutamate auxotrophy and a defect in sporulation [Pubmed|8045898]
  • The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA + H2O + oxaloacetate = citrate + CoA (according to Swiss-Prot)
  • Protein family

  • citrate synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|6684F6083B001E9FDC5967799B715AE966B83E1D|CitA], [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|MmgD]
  • Modification

  • phosphorylation on Ser-284 [Pubmed|17218307]
  • Effectors of protein activity

  • Inhibited by acetyl-CoA, 2-oxoglutarate and NADH [Pubmed|4211224] [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T36-44C8RWC-SH&_user=5731894&_coverDate=01/01/1985&_rdoc=28&_fmt=high&_orig=browse&_srch=doc-info(#toc#4938#1985#998209998#270526#FLP#display#Volume)&_cdi=4938&_sort=d&_docanchor=&_ct=40&_acct=C000043105&_version=1&_urlVersion=0&_userid=5731894&md5=f14f4734123ab1177d7217cab6c7ce7d FEBS Letters]
  • Inhibited by citrate and CoA (competitively against acetyl-CoA and non-competitively against oxaloacetate) [Pubmed|4211224]
  • Inhibited by ATP competitively in ''B. subtilis'' strain 168 and HS 1A17 [Pubmed|4980242] [Pubmed|4211224]
  • In ''B. subtilis'' strain HS 2A2, ATP inhibits a non-competitive fashion [Pubmed|4211224]
  • Activated by AMP [Pubmed|4211224]
  • Structure

  • [PDB|2C6X]
  • [PDB|A discussion of citrate synthase structure]
  • [SW|Localization]

  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
  • Additional information

  • extensive information on the structure and enzymatic properties of CitZ can be found at [http://www.proteopedia.org/wiki/index.php/Citrate_synthase Proteopedia]
  • Expression and Regulation

    Operons

    genes
    [gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
    description
    [Pubmed|8045899]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045899], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: transcription repression [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA destabilization, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • ''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12100558]
  • view in new tab

    Biological materials

    Mutant

  • GP678 (erm), GP797 (spec) available in [SW|Jörg Stülke]'s lab
  • 1A999 (''citZ''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
  • GP790 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • GP797 (''citZ''::''spec''), allows expression of ''[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]'' and ''[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'', available in [SW|Jörg Stülke]'s lab
  • GP1281 (''citZ''::''erm''), allows expression of ''[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]'' and ''[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'', available in [SW|Jörg Stülke]'s lab
  • GP2331 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]''::''kan''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [SW|Jörg Stülke]'s lab
  • GP2333 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]''::''lox72''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE29140 (Δ[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAACATCTCCTTTT, downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
  • BKK29140 (Δ[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAACATCTCCTTTT, downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
  • Expression vector

  • pGP1120 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • pGP1776 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
  • pGP1761 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP2515 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP2261 (integration into [gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA], expression under the control of the xylose-inducible PxylA promoter in ''B. subtilis'', in [SW|pGP888]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Linc Sonenshein]'s lab
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany
  • [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

    Reviews

  • 3013232
  • Original publications

  • 10348849,8045899,22900538,10656796,12850135,17218307,12100558,9642180,8045898,8655569,4211224,4980242,20525796,24825009,20933603,23354745,24571712,29546354