SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


succinyl-CoA synthetase (alpha subunit)
31.23 kDa
protein length
300 aa Sequence Blast
gene length
900 bp Sequence Blast
TCA cycle
succinyl-CoA synthetase (alpha subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW|Substrate-level phosphorylation]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,681,617 → 1,682,519

    The protein

    Catalyzed reaction/ biological activity

  • ATP succinate CoA = ADP phosphate succinyl-CoA (according to Swiss-Prot)
  • Protein family

  • succinate/malate CoA ligase alpha subunit family (according to Swiss-Prot)
  • Kinetic information

  • Reversible Michaelis-Menten [ FEBS Letters]
  • Modification

  • phosphorylation on (Ser-19 OR Thr-20) [Pubmed|17218307]
  • Effectors of protein activity

  • Inhibited by 2-oxoglutarate, ATP and NADH [ FEBS Letters]
  • GTP is not accepted by the enzyme [ FEBS Letters]
  • Structure

  • [PDB|1JKJ] (E. coli)
  • Additional information

  • extensive information on the structure and enzymatic properties of succinyl-CoA synthetase can be found at [ Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (2.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12850135]
  • expression is heterogeneous [pubmed|29809139]
  • view in new tab

    Biological materials


  • GP720 (spc), available in [SW|Jörg Stülke]'s lab
  • 1A1008 ( ''sucD''::''spec''), [Pubmed| ], available at [ BGSC]
  • GP791 (''[gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • GP2344 (''[gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]''::''kan''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2345 (''[gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]''::''lox72''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE16100 (Δ[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTGGTCCCCTGCCT, downstream forward: _UP4_TAATAAAAAAGGGACAGCCG
  • BKK16100 (Δ[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTGGTCCCCTGCCT, downstream forward: _UP4_TAATAAAAAAGGGACAGCCG
  • GFP fusion

  • GP1435 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1425 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • **
  • References

  • 12850135,17218307,11976317,20933603,15378759,29809139