SubtiBank SubtiBank
ytcA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytcA

similar to to UDP-sugar dehydrogenase
locus
BSU_30860
pI
5.94
mw
46.67 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,155,725 3,157,011

    The protein

    Catalyzed reaction/ biological activity

  • H2O + 2 NAD+ + UDP-α-D-glucose --> 3 H+ + 2 NADH + UDP-α-D-glucuronate (according to UniProt)
  • Protein family

  • UDP-glucose/GDP-mannose dehydrogenase family (with [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|TuaD] and [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd], according to UniProt)
  • Paralogous protein(s)

  • [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|TuaD], [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd]
  • Structure

  • [PDB|4A7P] (from ''Sphingomonas elodea'', 39% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]-[gene|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB]-[gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849,15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC], [SW|GerE]) [Pubmed|26577401,15699190,12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A280 (ytcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/280 NBRP B. subtilis, Japan]
  • BKE30860 ([gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCTGAGCTCCTTTAC, downstream forward: _UP4_ATCTGTACGGGAGTTGGCCG
  • BKK30860 ([gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCTGAGCTCCTTTAC, downstream forward: _UP4_ATCTGTACGGGAGTTGGCCG
  • References

  • 22383849,26577401