SubtiBank SubtiBank
ylaK
The papers of the month are back! Check them out! Link here

ylaK

similar to phosphate starvation inducible protein PhoH
locus
BSU14810
pI
5.42
mw
49.17 kDa
protein length
442 aa Sequence Blast
gene length
1326 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,549,465 → 1,550,793

    The protein

    Paralogous protein(s)

  • [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|PhoH]:
  • Biological materials

    Mutant

  • MGNA-A540 (ylaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/540 NBRP B. subtilis, Japan]
  • BKE14810 (Δ[gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA, downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
  • BKK14810 (Δ[gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA, downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
  • References

  • 12762842,12107147