SubtiBank SubtiBank
ylaK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ylaK

similar to phosphate starvation inducible protein [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|PhoH]
locus
BSU_14810
pI
5.42
mw
49.17 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,549,465 1,550,793

    The protein

    Protein family

  • C-terminal part: phoH family (with [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|PhoH], according to UniProt)
  • Paralogous protein(s)

  • [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|PhoH]:
  • [SW|Domains]

  • PINc domain (aa 3-135) (according to UniProt)
  • Structure

  • [PDB|3B85] (aa 233-399, from Corynebacterium glutamicum, 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]-[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]
    description
    [pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A540 (ylaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/540 NBRP B. subtilis, Japan]
  • BKE14810 ([gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA, downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
  • BKK14810 ([gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA, downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
  • References

  • 12762842,12107147