SubtiBank SubtiBank
yhgD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhgD

similar to transcriptional regulator ([SW|TetR family])
locus
BSU_10150
pI
7.24
mw
21.65 kDa
protein length
191 aa Sequence Blast
gene length
576 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yixD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    1,089,755 1,090,330

    The protein

    Protein family

  • [SW|TetR family]
  • Structure

  • [PDB|5K7F] (from Myxococcus xanthus, 24% identity) [pubmed|27940564]
  • Expression and Regulation

    Operons

    genes
    [gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]-[gene|8CA084B7BAA4969534DFEFBAFE31D25125354630|yhgE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B504 (yhgD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1503 NBRP B. subtilis, Japan]
  • BKE10150 ([gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTATTCACCTCGAAAC, downstream forward: _UP4_TAGATAATCCTTTCTCTTTG
  • BKK10150 ([gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTATTCACCTCGAAAC, downstream forward: _UP4_TAGATAATCCTTTCTCTTTG
  • References

    Reviews

  • 24006471
  • Research papers

  • 27940564