SubtiBank SubtiBank
kimA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

kimA

high-affinity potassium transporter (uptake)
locus
BSU04320
pI
9.93
mw
66.60 kDa
protein length
607 aa Sequence Blast
gene length
1821 bp Sequence Blast
function
potassium uptake
product
high-affinity potassium transporter
essential
no
synonyms
ydaO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    486,432 → 488,255

    Phenotypes of a mutant

  • a [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA] [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] [gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of potassium [pubmed|28420751]
  • [SW|Domains]

  • 11 trans-membrane helices at the N-terminus [pubmed|28420751]
  • [SW|Localization]

  • cell membrane (according to [http://www.uniprot.org/uniprot/P96589 UniProt])
  • Expression and Regulation

    Operons

    genes
    [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [regulon|ydaO riboswitch|ydaO riboswitch]: termination/antitermination, expression is switched off upon binding of c-di-AMP (formed at high potassium concentration) [pubmed|28420751], in [regulon|ydaO riboswitch|ydaO riboswitch]
  • regulation

  • expressed at low potassium concentration ([regulon|ydaO riboswitch|ydaO riboswitch]) [Pubmed|28420751]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C090 (kimA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2088 NBRP B. subtilis, Japan]
  • 1A688 (''[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]''::''erm''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A688&Search=1A688 BGSC]
  • GP93 (Δ[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04320 (Δ[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG
  • BKK04320 (Δ[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG
  • GP2720 (Δ[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2721 (Δ[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • Expression vector

  • pGP2913 (N-terminal His-tag, expression in ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • lacZ fusion

  • BP144 (based on [SW|pAC5]), available in [SW|Fabian Commichau]' and [SW|Jörg Stülke]'s labs [pubmed|28420751]
  • FLAG-tag construct

  • GP2405 ''ydaO-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • Labs working on this gene/protein

  • [SW|Jörg Stülke], Göttingen, Germany
  • References

    Reviews

  • 25869574,28825218
  • Original publications

  • 15096624,20511502,23086297,24141192,25086509,25086507,28420751,28679749