SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glycine betaine and arsenobetaine transporter
55.95 kDa
protein length
512 aa Sequence Blast
gene length
1539 bp Sequence Blast
compatible solute transport
glycine betaine transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Uptake of compatible solutes]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,076,818 3,078,356

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine and arsenobetaine [pubmed|29159878]
  • Protein family

  • BCCT transporter (TC 2.A.15) family (single member, according to UniProt)
  • Structure

  • [PDB|4AIN] (BetP from Corynebacterium glutamicum, 44% identity) [pubmed|22940865]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21296969], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|21296969], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by cold stress [Pubmed|21296969]
  • view in new tab

    Biological materials


  • MGNA-A815 (opuD::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A1052 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • 1A1053 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • 1A1054 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • 1A1055 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • BKE30070 ([gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACCCTCTAATTT, downstream forward: _UP4_TAACAAAAAAGATCTTTCCG
  • BKK30070 ([gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACCCTCTAATTT, downstream forward: _UP4_TAACAAAAAAGATCTTTCCG
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 27935846
  • Original publications

  • 8752321,21296969,8752321,29159878,22940865