SubtiBank SubtiBank
yjmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjmB

similar to Na+:galactoside symporter
locus
BSU_12310
pI
9.83
mw
50.26 kDa
protein length
459 aa Sequence Blast
gene length
1380 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,301,939 1,303,318

    The protein

    Protein family

  • [SW|sodium:galactoside symporter (TC 2.A.2) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B13F7C35FBD55C674E5B19836D32279E7C1A5520|GutP], [protein|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|XynP]
  • Structure

  • [PDB|4M64] (melibiose permease from Salmonella typhimurium, 31% identity) [pubmed|24389923]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A366 (yjmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/366 NBRP B. subtilis, Japan]
  • BKE12310 ([gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCACCTCTGTGTCT, downstream forward: _UP4_TGACAATATAATATAAAGAA
  • BKK12310 ([gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCACCTCTGTGTCT, downstream forward: _UP4_TGACAATATAATATAAAGAA
  • References

  • 9579062,9882655,10666464,24389923