SubtiBank SubtiBank
yjmB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjmB

similar to Na+:galactoside symporter
locus
BSU_12310
pI
9.83
mw
50.26 kDa
protein length
459 aa Sequence Blast
gene length
1380 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,301,939 1,303,318

    The protein

    Protein family

  • [SW|sodium:galactoside symporter (TC 2.A.2) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B13F7C35FBD55C674E5B19836D32279E7C1A5520|GutP], [protein|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|XynP]
  • Structure

  • [PDB|4M64] (melibiose permease from Salmonella typhimurium, 31% identity) [pubmed|24389923]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A366 (yjmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/366 NBRP B. subtilis, Japan]
  • BKE12310 ([gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCACCTCTGTGTCT, downstream forward: _UP4_TGACAATATAATATAAAGAA
  • BKK12310 ([gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCACCTCTGTGTCT, downstream forward: _UP4_TGACAATATAATATAAAGAA
  • References

  • 9579062,9882655,10666464,24389923