SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcriptional regulator ([SW|GntR family])
27.13 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
transcriptional regulator ([SW|GntR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    4,123,193 4,123,903

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 1-69) (according to UniProt)
  • Structure

  • [PDB|3BWG]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B806 (yydK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40130 ([gene|59EBB1812BA939110BC00ACE30057AB987E61B30|yydK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCATTCCTCATTTAT, downstream forward: _UP4_TAGGGCTCTTCACTACGGTA
  • BKK40130 ([gene|59EBB1812BA939110BC00ACE30057AB987E61B30|yydK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGCATTCCTCATTTAT, downstream forward: _UP4_TAGGGCTCTTCACTACGGTA
  • References

  • 23504016