SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase, detects extracellular [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX]
89.13 kDa
protein length
769 aa Sequence Blast
gene length
2310 bp Sequence Blast
regulation of genetic competence and quorum sensing
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,253,529 3,255,838

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation
  • phosphorylation of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] when bound to [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • eight transmembrane segments
  • [SW|Histidine kinase domain] (aa 571-769) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX] (extracellular)
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE31690 ([gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATTAATCCACCTATTA, downstream forward: _UP4_TAATGGATTTATAACGGAAA
  • BKK31690 ([gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATTAATCCACCTATTA, downstream forward: _UP4_TAATGGATTTATAACGGAAA
  • References


  • 12576575,30218468
  • Original Publications

  • 11133937,8643670,12067344,10094672,10419951,2116363,9274030,18763711,24296669,24130811,24425772,24788106,25757097,26787913,26927849,29038467