SubtiBank SubtiBank
uxaC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

uxaC

glucuronate isomerase (D-glucuronate, D-galacturonate)
locus
BSU_12300
pI
5.17
mw
54.44 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
hexuronate utilization
product
glucuronate isomerase (D-glucuronate, D-galacturonate)
essential
no
ec
5.3.1.12
synonyms
yjmA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • Gene

    Coordinates
    1,300,450 1,301,871

    The protein

    Catalyzed reaction/ biological activity

  • D-glucuronate --> D-fructuronate (according to UniProt)
  • aldehydo-D-galacturonate --> keto-D-tagaturonate (according to UniProt)
  • Protein family

  • [SW|metallo-dependent hydrolases superfamily] (according to UniProt)
  • Structure

  • [PDB|3IAC] (from Salmonella typhimurium, 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A365 (yjmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/365 NBRP B. subtilis, Japan]
  • BKE12300 ([gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCGTCTTTCA, downstream forward: _UP4_TAACAAAGTGTCCGCTCAGT
  • BKK12300 ([gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCGTCTTTCA, downstream forward: _UP4_TAACAAAGTGTCCGCTCAGT
  • References

  • 9579062,22900538,9579062,9882655,10666464