SubtiBank SubtiBank
uxaC [2019-06-27 15:39:41]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

uxaC [2019-06-27 15:39:41]

glucuronate isomerase (D-glucuronate, D-galacturonate)
54.44 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
hexuronate utilization
glucuronate isomerase (D-glucuronate, D-galacturonate)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of hexuronate]
  • Gene

    1,300,450 1,301,871

    The protein

    Catalyzed reaction/ biological activity

  • D-glucuronate = D-fructuronate (according to Swiss-Prot)
  • Protein family

  • uronate isomerase family (according to Swiss-Prot)
  • Structure

  • [PDB|3IAC] (from Salmonella typhimurium, 49% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials


  • MGNA-A365 (yjmA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12300 ([gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCGTCTTTCA, downstream forward: _UP4_TAACAAAGTGTCCGCTCAGT
  • BKK12300 ([gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCGTCTTTCA, downstream forward: _UP4_TAACAAAGTGTCCGCTCAGT
  • References

  • 9579062,22900538,9579062,9882655,10666464