SubtiBank SubtiBank
ytxO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ytxO

outer spore coat protein
locus
BSU_30890
pI
4.40
mw
16.41 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
protection of the spore
product
outer spore coat protein
essential
no
synonyms
ytbB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    3,159,258 3,159,689

    The protein

    [SW|Localization]

  • outer spore coat [Pubmed|19933362]
  • localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|2C17028E7DC755FFC190397AC6509E383C4DF99A|cotSA]-[gene|DC99E507696A1CB23140A1CBA45DA07D1F7C7D53|cotS]-[gene|5A13CEBB6820454E38DE81C1663078531B2AE4C2|ytxO]
    description
    [Pubmed|9603889]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,9603889], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,9603889]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B541 (ytxO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1540 NBRP B. subtilis, Japan]
  • BKE30890 ([gene|5A13CEBB6820454E38DE81C1663078531B2AE4C2|ytxO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTTTTTGTCTCGATGACC, downstream forward: _UP4_TAAAGTCACATTTATGCCTT
  • BKK30890 ([gene|5A13CEBB6820454E38DE81C1663078531B2AE4C2|ytxO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTTTTTGTCTCGATGACC, downstream forward: _UP4_TAAAGTCACATTTATGCCTT
  • References

    Reviews

  • 23202530
  • Original publications

  • 15383836,19933362,15699190,9603889,22171814