SubtiBank SubtiBank
hemZ

hemZ

coproporphyrinogen III oxidase
locus
BSU_09840
pI
5.90
mw
57.00 kDa
protein length
501 aa Sequence Blast
gene length
1506 bp Sequence Blast
function
heme biosynthesis
product
coproporphyrinogen III oxidase
essential
no
synonyms
yhaW,yhaV

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    1,057,680 1,059,185

    The protein

    Protein family

  • anaerobic coproporphyrinogen-III oxidase family (with [protein|757C51296E198849EAC1FFA4D37121D9085930A8|HemN], according to UniProt)
  • Paralogous protein(s)

  • [protein|757C51296E198849EAC1FFA4D37121D9085930A8|HemN]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation

    Operons

    genes
    [gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]
    description
    [Pubmed|10498703]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10498703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • regulation

  • induced under anaerobic conditions during growth in the presence of nitrate (no induction in the absence of terminal electron acceptor) ([protein|search|Fnr], [protein|search|ResD], [protein|search|ArfM]) [Pubmed|10498703]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B497 (yhaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1496 NBRP B. subtilis, Japan]
  • BKE09840 ([gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCATCACCTAATTTA, downstream forward: _UP4_CACTGATTACAGTGCTGCTT
  • BKK09840 ([gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCATCACCTAATTTA, downstream forward: _UP4_CACTGATTACAGTGCTGCTT
  • References

  • 10498703