SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|sporulation]-specific extracellular nuclease
14.83 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
DNA degradation after mother cell lysis
[SW|sporulation]-specific extracellular nuclease

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,652,387 2,652,797

    The protein


  • [PDB|5OMT] ([protein|search|NucB ]from B. licheniformis, 77% identity, aa 27 - 136) [pubmed|29165717]
  • [SW|Localization]

  • extracellular(signal peptide)(according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7746143], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|7746143]
  • view in new tab

    Biological materials


  • BKE25750 ([gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCATCCCCCCATACC, downstream forward: _UP4_TAGTAAAGAAGAGGCTCTTT
  • BKK25750 ([gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCATCCCCCCATACC, downstream forward: _UP4_TAGTAAAGAAGAGGCTCTTT
  • References

  • 17209033,7746143,29165717