SubtiBank SubtiBank
yxiE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yxiE

unknown
locus
BSU_39250
pI
6.34
mw
15.80 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,031,797 4,032,243

    The protein

    Protein family

  • universal stress protein A family (with [protein|D0BBFE1706429A98B7E93998794061A112FE8ECA|NhaX], according to UniProt)
  • Structure

  • [PDB|3HGM] (from Halomonas elongata, 35% identity) [pubmed|20113006]
  • Expression and Regulation

    Operons

    genes
    [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]-[gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]
    description
    [Pubmed|7883710]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7559347], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] binding site overlaps -35 region) [Pubmed|7559347], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]: anti-termination, via [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent [SW|RNA switch], lack of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent antitermination in the presence of gucose due to the requirement of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT] to be phosphorylated by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK], in [regulon|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT regulon]
  • regulation

  • induced by salicin ([protein|search|LicT]) [Pubmed|7883710]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|bglP]' [PubMed|20525796]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B788 (yxiE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1787 NBRP B. subtilis, Japan]
  • BKE39250 ([gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCTTCCCGCCTTTCG, downstream forward: _UP4_TAGATTTGTAAAAAAAGCGC
  • BKK39250 ([gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCTTCCCGCCTTTCG, downstream forward: _UP4_TAGATTTGTAAAAAAAGCGC
  • References

  • 16672620,10913081,26883633,20113006