SubtiBank SubtiBank
yxiE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxiE

unknown
locus
BSU_39250
pI
6.34
mw
15.80 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,031,797 4,032,243

    The protein

    Protein family

  • universal stress protein A family (with [protein|D0BBFE1706429A98B7E93998794061A112FE8ECA|NhaX], according to UniProt)
  • Structure

  • [PDB|3HGM] (from Halomonas elongata, 35% identity) [pubmed|20113006]
  • Expression and Regulation

    Operons

    genes
    [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]-[gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]
    description
    [Pubmed|7883710]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7559347], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] binding site overlaps -35 region) [Pubmed|7559347], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]: anti-termination, via [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent [SW|RNA switch], lack of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent antitermination in the presence of gucose due to the requirement of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT] to be phosphorylated by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK], in [regulon|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT regulon]
  • regulation

  • induced by salicin ([protein|search|LicT]) [Pubmed|7883710]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|bglP]' [PubMed|20525796]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B788 (yxiE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1787 NBRP B. subtilis, Japan]
  • BKE39250 ([gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCTTCCCGCCTTTCG, downstream forward: _UP4_TAGATTTGTAAAAAAAGCGC
  • BKK39250 ([gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCTTCCCGCCTTTCG, downstream forward: _UP4_TAGATTTGTAAAAAAAGCGC
  • References

  • 16672620,10913081,26883633,20113006