SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional regulator ([SW|Xre family]) of post-exponential-phase responses genes
12.85 kDa
protein length
111 aa Sequence Blast
gene length
333 bp Sequence Blast
control of [SW|biofilm formation]
transcriptional regulator ([SW|Xre family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • Gene

    2,552,653 → 2,552,988

    Phenotypes of a mutant

  • the mutation suppresses the galactose toxicity to a'' [gene|314223775ECB9E969F4F898584FC4E5379E86C7F|galE]'' mutant [Pubmed|22893383]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription regulator of biofilm genes, acts as a true repressor of the ''[gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]'' operon and as an anti-activator (prevents binding of the activator protein [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) of the ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]'' operon [Pubmed|23646920]
  • acts as co-repressor for [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] [Pubmed|20351052]
  • Protein family

  • [SW|Xre family]
  • Paralogous protein(s)

  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]
  • [SW|Domains]

  • DNA-binding N-terminal domain (aa 1-69) [Pubmed|21708175]
  • [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]-binding C-terminal domain (aa 74-111) [Pubmed|21708175]
  • Effectors of protein activity

  • [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] and [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] are antagonists to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|19788541]
  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] is also antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|20351052]
  • Structure

  • [PDB|2YAL] (C-terminal domain, aa 74-111) [Pubmed|21708175]
  • [PDB|3QQ6] (N-terminal domain, aa 1-69) [Pubmed|21708175]
  • [PDB|1B0N] (complex [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]-[protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]) [Pubmed|9799632]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3125149], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, in a portion of cells [Pubmed|11751836], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|1664536], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|7635837,11751836], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [PubMed|1906467,11751836], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]) [,11751836 PubMed]
  • view in new tab

    view in new tab

    Biological materials


  • GP923 (''sinR::spec'') [Pubmed|21856853], available in [SW|Jörg Stülke]'s lab
  • GP736 (''sinR::tetR'') [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • 1S97 (''sinR''::''phleo''), [Pubmed|8422983], available at [ BGSC]
  • GP1672 (''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''::''cat'') [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • GP1663 (''[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]-[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''), available in [SW|Jörg Stülke]'s lab
  • BKE24610 (Δ[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATCACCTTCCTTG, downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC
  • BKK24610 (Δ[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATCACCTTCCTTG, downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC
  • Expression vector

  • N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]: pGP1083 , available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP1930 (aphA3) based on [protein|search|pAC7], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP960 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 20395361,20541494,23353768,24988880
  • Modelling of the [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]/[protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] switch

  • 21095906
  • Original publications

  • 22893383,23378512,23430750,23475644,21856853,21815947,22329926,21326214,21708175,8955328,15661000,8878039,24317403,16923912,15104138,16430695,16430696,18047568,18430133,1906467,7635837,11751836,19201793,10547280,9799632,19788541,19898538,3125149,8932324,20351052,20923420,8422983,9685500,9158733,23646920,23660663,24256735,24347549,25433524,26283769,26819068,26434553,28546427,29321771