SubtiBank SubtiBank
ybaE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybaE

ATP-binding A2 component of [SW|ECF transporter]s
locus
BSU_01460
pI
5.82
mw
30.43 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
uptake of micronutrients
product
[SW|ECF transporter] (ATP-binding protein)
essential
no
ec
3.6.3.-
synonyms
ecfA2

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.1|The general components of the ECF transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    151,303 152,133

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D8637043C7E2291589C966E95F94DC61B1A8AB75|YbxA]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 1-233) (according to UniProt)
  • Structure

  • [PDB|4HUQ] (EcfA1-EcfA2-EcfT-FolT complex of ''Lactobacillus brevis''), [Pubmed|23584589]
  • [SW|Localization]

  • membrane associated (via [protein|7DC7BD54ED425859FFD45B8B6F3522750A938835|YbaF]) [Pubmed|10092453]
  • Biological materials

    Mutant

  • BKE01460 ([gene|5ABF4F7A3D00B523F67B281241A6A8101EC60057|ybaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCTTCATCTGATAGCGAT, downstream forward: _UP4_CTTTTTCAGGGAGAGAAGAC
  • BKK01460 ([gene|5ABF4F7A3D00B523F67B281241A6A8101EC60057|ybaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCTTCATCTGATAGCGAT, downstream forward: _UP4_CTTTTTCAGGGAGAGAAGAC
  • References

  • 10092453,20497229,22574898,24362466