SubtiBank SubtiBank
yfkC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfkC

mechanosensitive channel, similar to MscS
locus
BSU_07940
pI
5.29
mw
32.05 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
resistance to osmotic downshock
product
mechanosensitive channel, similar to MscS
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    867,164 868,006

    The protein

    Protein family

  • [SW|MscS (TC 1.A.23) family] (according to UniProt)
  • Structure

  • [PDB|3UDC] (from Caldanaerobacter subterraneus subsp. tengcongensis, 36% identity) [pubmed|23074248]
  • [SW|Localization]

  • cell membrane [Pubmed|19252899]
  • Expression and Regulation

    Operons

    genes
    [gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]-[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C271 (yfkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2269 NBRP B. subtilis, Japan]
  • 1A959 ( ''yfkC''::''tet''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A959&Search=1A959 BGSC]
  • BKE07940 ([gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTGTTTCTTTCATCC, downstream forward: _UP4_TAAACAAAAAAACTGATTCC
  • BKK07940 ([gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTGTTTCTTTCATCC, downstream forward: _UP4_TAAACAAAAAAACTGATTCC
  • GP2785 (''Δ''''[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 12626684,22685280,22404681,24607989,17505523
  • Original Publications

  • 17665170,18310427,19252899,22383849,23074248
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]