SubtiBank SubtiBank
yjdJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjdJ

unknown
locus
BSU_12070
pI
7.89
mw
12.32 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,278,565 1,278,894

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A274 (yjdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/274 NBRP B. subtilis, Japan]
  • BKE12070 ([gene|5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E|yjdJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTGTATGACCTCCAA, downstream forward: _UP4_TGACCCGGTAAAATTCGTTT
  • BKK12070 ([gene|5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E|yjdJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTGTATGACCTCCAA, downstream forward: _UP4_TGACCCGGTAAAATTCGTTT
  • GP2581 ([gene|5AD33ED996C3569A27E6E32B8E31DFDD42ECD86E|yjdJ]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab