SubtiBank SubtiBank
yvrN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvrN

similar to [SW|ABC transporter] (membrane protein)
locus
BSU_33260
pI
4.86
mw
44.95 kDa
protein length
409 aa Sequence Blast
gene length
1230 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (membrane protein)
essential
no
synonyms
yziB,yvrM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,412,128 3,413,357

    The protein

    Protein family

  • [SW|ABC-4 integral membrane protein family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|YknZ]
  • Structure

  • [PDB|5WS4] (from Acinetobacter baumanni, 32% identity) [pubmed|29109439]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7D334BBF7628D1DA001727CF7BEDB4EFA7FF88BA|yvrP]-[gene|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]-[gene|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|yvrN]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B056 (yvrN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1055 NBRP B. subtilis, Japan]
  • BKE33260 ([gene|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|yvrN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGATTGAAAGGAGATTCGAA, downstream forward: _UP4_TAAAAAGAACGCATCCAATT
  • BKK33260 ([gene|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|yvrN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGATTGAAAGGAGATTCGAA, downstream forward: _UP4_TAAAAAGAACGCATCCAATT
  • References

  • 10092453,11948146,20817675,29109439