SubtiBank SubtiBank
yisR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisR

similar to transcription factor ([SW|AraC family])
locus
BSU_10830
pI
7.38
mw
33.05 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yuxC,yucF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    1,162,267 1,163,130

    The protein

    Protein family

  • [SW|AraC family]
  • Expression and Regulation

    Operons

    genes
    [gene|5B173B400D0B4C150E94A98D35E27B0B4358489B|yisR]-[gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B212 (yisR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1211 NBRP B. subtilis, Japan]
  • BKE10830 ([gene|5B173B400D0B4C150E94A98D35E27B0B4358489B|yisR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATCATCCTCCTTT, downstream forward: _UP4_CAATAACCAGACGAGGGATG
  • BKK10830 ([gene|5B173B400D0B4C150E94A98D35E27B0B4358489B|yisR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATCATCCTCCTTT, downstream forward: _UP4_CAATAACCAGACGAGGGATG
  • References

  • 23504016