SubtiBank SubtiBank
mtnN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mtnN

methylthioadenosine nucleosidase
locus
BSU_27270
pI
4.84
mw
25.12 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
methionine salvage
product
methylthioadenosine nucleosidase
essential
no
ec
3.2.2.9
synonyms
yrrU,mtn,mthA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    Coordinates
    2,787,130 2,787,825

    The protein

    Catalyzed reaction/ biological activity

  • H2O + S-adenosyl-L-homocysteine --> adenine + S-(5-deoxy-D-ribos-5-yl)-L-homocysteine (according to UniProt)
  • H2O + S-methyl-5'-thioadenosine --> adenine + S-methyl-5-thio-D-ribose (according to UniProt)
  • Protein family

  • PNP/UDP phosphorylase family (with [protein|3075327DBE55C4F628171AEE248CAED5870693FA|DeoD], according to UniProt)
  • Structure

  • [PDB|1JYS] (from ''Escherichia coli'', 51% identity, 70% similarity) [Pubmed|11591349]
  • Expression and Regulation

    Operons

    genes
    [gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]-[gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]-[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]-[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]-[gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]
    description
    [Pubmed|17056751]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,16885442], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A850 (yrrU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/850 NBRP B. subtilis, Japan]
  • BKE27270 ([gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCACATTCCCTTC, downstream forward: _UP4_TAAAACGGGGAGAACGTTCT
  • BKK27270 ([gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCACATTCCCTTC, downstream forward: _UP4_TAAAACGGGGAGAACGTTCT
  • References

  • 17056751,16513748,12642660,15102328,16885442,24509311