SubtiBank SubtiBank
yvrJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvrJ

may be involved in response to acid stress
locus
BSU_33239
pI
9.10
mw
13.00 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • Gene

    Coordinates
    3,410,007 3,410,345

    The protein

    Structure

  • [PDB|3P56] (human protein, 29% identity) [pubmed|21177854]
  • Expression and Regulation

    Operons

    genes
    [gene|5B4A7F4DEA1252A396DD8D5EC9D94FF5EFADD9BA|yvrJ]
    description
    [Pubmed|19047353]

    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials

    Mutant

  • BKE33239 ([gene|5B4A7F4DEA1252A396DD8D5EC9D94FF5EFADD9BA|yvrJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33239 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACGGTCAAAATGTAAGGAG, downstream forward: _UP4_TAATTTTTCAATCGAAGTTG
  • BKK33239 ([gene|5B4A7F4DEA1252A396DD8D5EC9D94FF5EFADD9BA|yvrJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33239 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACGGTCAAAATGTAAGGAG, downstream forward: _UP4_TAATTTTTCAATCGAAGTTG
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 18573182,19047353,19047353,21177854