SubtiBank SubtiBank
yefC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yefC

similar to resolvase
locus
BSU_06750
pI
9.82
mw
13.94 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    739,878 740,213

    The protein

    Protein family

  • [SW|site-specific recombinase resolvase family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]-[gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]-[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]-[gene|2E55D086DD5023B98929FB8B61238C00E66B8BCB|yeeB]-[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A962 (yefC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/962 NBRP B. subtilis, Japan]
  • BKE06750 ([gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTTTGATGCAATAGCAA, downstream forward: _UP4_TAAATATTGTGAATTAATTA
  • BKK06750 ([gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTTTGATGCAATAGCAA, downstream forward: _UP4_TAAATATTGTGAATTAATTA