SubtiBank SubtiBank
yvaQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvaQ

membrane-bound chemotaxis receptor, similar to methyl-accepting chemotaxis protein
locus
BSU_33690
pI
4.62
mw
62.66 kDa
protein length
566 aa Sequence Blast
gene length
1701 bp Sequence Blast
function
control of chemotaxis
product
membrane-bound chemotaxis receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,458,066 3,459,766

    The protein

    [SW|Domains]

  • [SW|HAMP domain] (aa 67-120) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 280-530) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5B7221124BE633795213229EBC2452B0C7B51F8E|yvaQ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A508 (yvaQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/508 NBRP B. subtilis, Japan]
  • BKE33690 ([gene|5B7221124BE633795213229EBC2452B0C7B51F8E|yvaQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGTGGTCTCCTTTAA, downstream forward: _UP4_TAAAGAGAAAAAAGAGGCTG
  • BKK33690 ([gene|5B7221124BE633795213229EBC2452B0C7B51F8E|yvaQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGTGGTCTCCTTTAA, downstream forward: _UP4_TAAAGAGAAAAAAGAGGCTG
  • References

  • 21515776,26577401