SubtiBank SubtiBank
rnmV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rnmV

RNase M5
locus
BSU_00410
pI
6.68
mw
20.53 kDa
protein length
186 aa Sequence Blast
gene length
561 bp Sequence Blast
function
5S ribosomal RNA maturation
product
endoribonuclease M5
essential
no
synonyms
yabF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    50,087 50,647

    The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage of RNA, removing 21 and 42 nucleotides, respectively, from the 5'- and 3'-termini of a 5S-rRNA precursor (according to UniProt)
  • Protein family

  • Ribonuclease M5 family (single member, according to UniProt)
  • [SW|Domains]

  • N-terminal [SW|TOPRIM domain] (aa 4-94) [Pubmed|9722641,16077031]
  • [SW|Localization]

  • cytoplasm (homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|5BA7AA691CFE4635DEFBD0B8B820F487B58A5DB7|rnmV]-[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]
    description
    [Pubmed|11233981]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B906 (yabF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1905 NBRP B. subtilis, Japan]
  • BKE00410 ([gene|5BA7AA691CFE4635DEFBD0B8B820F487B58A5DB7|rnmV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCCTCCAAGACAA, downstream forward: _UP4_GATACCGTTATGCGGGAGGA
  • BKK00410 ([gene|5BA7AA691CFE4635DEFBD0B8B820F487B58A5DB7|rnmV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCCTCCAAGACAA, downstream forward: _UP4_GATACCGTTATGCGGGAGGA
  • labs

  • [SW|Ciaran Condon], IBPC, Paris, France [http://www.ibpc.fr/UPR9073/condon/index_en.html Homepage]
  • References

    Reviews

  • 31464530
  • Original Publications

  • 16479537,11233981,11976317,16077031,9722641,32991829