SubtiBank SubtiBank
aroH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aroH

chorismate mutase (isozymes 1 and 2)
locus
BSU_22690
pI
5.52
mw
14.38 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
chorismate mutase (isozymes 1 and 2)
essential
no
ec
5.4.99.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,377,632 2,378,015

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate --> prephenate (according to UniProt)
  • Structure

  • [PDB|2CHT] (complex with a transition state analog) [pubmed|8378335]
  • [PDB|1DBF]
  • Expression and Regulation

    Operons

    genes
    [gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]-[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|21815947]
    view in new tab

    Biological materials

    Mutant

  • BKE22690 ([gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCCGCGAATTCCGCGAA, downstream forward: _UP4_TAATACGATAAGAACAGCTT
  • BKK22690 ([gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCCGCGAATTCCGCGAA, downstream forward: _UP4_TAATACGATAAGAACAGCTT
  • References

    Reviews

  • 12698486,9383421,12966138
  • Original publications

  • 8378335,25422475,12630863,10960481,2105742,8643526,26278727,26641683,21243152,15034619,14709097,21815947,28743924