SubtiBank SubtiBank
gbsR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gbsR

transcription repressor of the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] and [gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB] operons
locus
BSU_31070
pI
4.62
mw
20.92 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
regulation of osmoprotection
product
transcription repressor
essential
no
synonyms
yuaC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.4|Biosynthesis of glycine betaine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    3,186,763 3,187,305

    The protein

    Catalyzed reaction/ biological activity

  • sensing of choline and arsenocholine [Pubmed|29159878,22408163]
  • control of the [gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB] and [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] operons [Pubmed|22408163]
  • Protein family

  • GbsR family (with [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR] and [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV], according to UniProt)
  • Effectors of protein activity

  • binds the inducer choline with an apparent K(D) of approximately 165 M [Pubmed|22408163]
  • binds the inducer arsenocholine with an apparent K(D) of approximately 2.1 mM [Pubmed|29159878]
  • Expression and Regulation

    Operons

    genes
    [gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]
    description
    [Pubmed|22383849]

    regulation

  • upregulated in response to salt stress [Pubmed|32849357]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A219 (yuaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/219 NBRP B. subtilis, Japan]
  • BKE31070 ([gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGACCCTCTTTTCCT, downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
  • BKK31070 ([gene|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGACCCTCTTTTCCT, downstream forward: _UP4_TAAAGCAGAAAACGCCTGGG
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

  • 22408163,28256787,29159878,32849357