SubtiBank SubtiBank
moaD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

moaD

molybdopterin synthase (small subunit)
locus
BSU_14310
pI
3.83
mw
7.97 kDa
protein length
gene length
234 bp Sequence Blast
function
nitrate respiration
product
molybdopterin synthase (small subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    1,499,432 1,499,665

    The protein

    Protein family

  • MoaD family (single member, according to UniProt)
  • Structure

  • [PDB|1NVI] (the [protein|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|MoaD]-[protein|12F27FA4DB8232B52271565C4F4937520A4F5C7B|MoaE] complex from ''E. coli'') [Pubmed|12571227]
  • Expression and Regulation

    Operons

    genes
    [gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]-[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]-[gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]-[gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]-[gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]-[gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14310 ([gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAAGCCCTGCAAATAAAA, downstream forward: _UP4_TGAAAACCGGACGGCATTTC
  • BKK14310 ([gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCAAGCCCTGCAAATAAAA, downstream forward: _UP4_TGAAAACCGGACGGCATTTC
  • References

    Reviews

  • 22616866,23539623
  • Original publications

  • 12571227,22383849