SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribosomal large subunit pseudouridine synthase B
25.88 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
23S rRNA modification
pseudouridine synthase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation]
  • Gene

    2,421,438 2,422,172

    The protein

    Catalyzed reaction/ biological activity

  • uridine2605 in 23S rRNA a pseudouridine2605 in 23S rRNA (according to E. coli RluB)
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to Interpro)
  • pseudouridine synthase RsuA family (with [protein|69052B24B577ABA4B20E610F679154DC97EFD8DE|YtzG], according to UniProt)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 2-68) (according to UniProt)
  • Structure

  • [PDB|4LAB] (from ''E. coli'', 40% identity) [Pubmed|24214967]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A106 (ypuL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23160 ([gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCACCTCAAGTA, downstream forward: _UP4_TAAATTTCACATAACCTTCA
  • BKK23160 ([gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCACCTCAAGTA, downstream forward: _UP4_TAAATTTCACATAACCTTCA
  • References

  • 9888802,24214967