SubtiBank SubtiBank
rluB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

rluB

ribosomal large subunit pseudouridine synthase B
locus
BSU_23160
pI
10.25
mw
25.88 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
23S rRNA modification
product
pseudouridine synthase
essential
no
ec
5.4.99.22
synonyms
ypuL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    2,421,438 2,422,172

    The protein

    Catalyzed reaction/ biological activity

  • uridine2605 in 23S rRNA a pseudouridine2605 in 23S rRNA (according to E. coli RluB)
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • pseudouridine synthase RsuA family (with [protein|69052B24B577ABA4B20E610F679154DC97EFD8DE|YtzG], according to UniProt)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 2-68) (according to UniProt)
  • Structure

  • [PDB|4LAB] (from ''E. coli'', 40% identity) [Pubmed|24214967]
  • Expression and Regulation

    Operons

    genes
    [gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A106 (ypuL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/106 NBRP B. subtilis, Japan]
  • BKE23160 ([gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCACCTCAAGTA, downstream forward: _UP4_TAAATTTCACATAACCTTCA
  • BKK23160 ([gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCACCTCAAGTA, downstream forward: _UP4_TAAATTTCACATAACCTTCA
  • References

  • 9888802,24214967