SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


25.88 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    1,594,492 1,595,187

    The protein

    Protein family

  • UPF0749 family (with [protein|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|YlxX], according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, (promoter within [protein|D52FDB5015B10E9B26D7FED5708457890C6EA43D|MurG]) [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8106328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab


    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth [Pubmed|1391053]
  • view in new tab



  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    view in new tab



  • expressed during vegatative growth, then switched off, and again expressed during [SW|sporulation ]in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    Biological materials


  • MGNA-B361 (ylxW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15250 ([gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCAATTTTCATCTTCCTT, downstream forward: _UP4_TGACTGAAAAAGCGGGTGAA
  • BKK15250 ([gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCAATTTTCATCTTCCTT, downstream forward: _UP4_TGACTGAAAAAGCGGGTGAA
  • References

  • 1391053,8106328,8320223,18179421