SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative pepdidoglycan binding protein
79.05 kDa
protein length
732 aa Sequence Blast
gene length
2199 bp Sequence Blast
putative pepdidoglycan binding protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    239,644 241,842

    The protein

    Protein family

  • fadG family (with [protein|0264C72F95D53F0211B52753DA37B4A8C0E982D2|FadG], according to UniProt)
  • Paralogous protein(s)

  • [protein|0264C72F95D53F0211B52753DA37B4A8C0E982D2|FadG]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • the mRNA is processed between [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG] and [gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B968 (ybfG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02200 ([gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGATTCCTCCTTTGT, downstream forward: _UP4_TAACTTTAATACAAAACTGC
  • BKK02200 ([gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGATTCCTCCTTTGT, downstream forward: _UP4_TAACTTTAATACAAAACTGC
  • References

    Research papers

  • 29794222