SubtiBank SubtiBank
epsE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

epsE

inhibitor of motility and glycosyltransferase required for EPS biosynthesis
locus
BSU_34330
pI
9.80
mw
32.05 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
function
biofilm formation
product
glycosyltransferase, inhibitor of motility
essential
no
synonyms
yveO

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    3,524,417 3,525,253

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Catalyzed reaction/ biological activity

  • arrests flagellar rotation in a manner similar to that of a clutch, by disengaging motor force-generating elements in cells embedded in the biofilm matrix, separates the cytoplasmic [protein|8DDCC3D139ACCB635BF014946E1282A72D535390|FliG] motor from the [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB] stator [Pubmed|18566286]
  • biosynthesis of extracellular polysaccharides [Pubmed|21170308]
  • Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Modification

  • phosphorylated by [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB] on a Tyr residue [Pubmed|25085422]
  • [SW|Localization]

  • cell membrane, forms spots at flagellar basal bodies [Pubmed|18566286]
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B613 (yveO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1612 NBRP B. subtilis, Japan]
  • BKE34330 ([gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT, downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
  • BKK34330 ([gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT, downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481,24988880,25251856
  • Research papers

  • 18566286,25085422,21170308,22113911
  • The EAR [SW|RNA switch]

  • 20374491,20230605