SubtiBank SubtiBank
ybcF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybcF

similar to carbonic anhydrase
locus
BSU_01860
pI
4.91
mw
19.36 kDa
protein length
175 aa Sequence Blast
gene length
528 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    209,633 210,160

    The protein

    Protein family

  • beta-class carbonic anhydrase family (with [protein|E00889289B07BE78CC0C8E0962A55C3B14871E00|YvdA] and [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB], according to UniProt)
  • Paralogous protein(s)

  • [protein|E00889289B07BE78CC0C8E0962A55C3B14871E00|YvdA]: (29.4%)
  • [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB]: (32%)
  • Expression and Regulation

    Operons

    genes
    [gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE01860 ([gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACACCTCTTCCT, downstream forward: _UP4_TGATGAAATGCAGGTTTAAC
  • BKK01860 ([gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACACCTCTTCCT, downstream forward: _UP4_TGATGAAATGCAGGTTTAAC