SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcription regulator ([SW|Xre family])
7.60 kDa
protein length
gene length
201 bp Sequence Blast
putative HTH-type transcriptional regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    966,671 966,871

    The protein

    Protein family

  • [SW|Xre family]
  • Structure

  • [PDB|1UTX] (from Enterococcus faecalis, 41% identity) [pubmed|15359276]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE08899 ([gene|5DB65F7EE4EFADFB0B46C2EE5726D4B9FA9D85E9|ygzD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGACGTCTGTCCCCT, downstream forward: _UP4_TTTTGGTTAGAGGAGGAAAA
  • BKK08899 ([gene|5DB65F7EE4EFADFB0B46C2EE5726D4B9FA9D85E9|ygzD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGACGTCTGTCCCCT, downstream forward: _UP4_TTTTGGTTAGAGGAGGAAAA
  • References

  • 23504016,15359276