SubtiBank SubtiBank
yloV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yloV

putative fatty acid kinase
locus
BSU_15840
pI
4.28
mw
59.32 kDa
protein length
553 aa Sequence Blast
gene length
1662 bp Sequence Blast
function
phosphorylation of fatty acids
product
putative fatty acid kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,656,442 1,658,103

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of fatty acids (bound to [protein|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|DegV] or [protein|C13F1870B014F8B2C16D9B169F40747DE5B51B85|YitS]) [pubmed|30429218]
  • Modification

  • phosphorylated on Arg-255 [Pubmed|22517742]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU]-[gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|yloV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B137 (yloV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1136 NBRP B. subtilis, Japan]
  • GP1466 (''yloV''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP1467 (''[gene|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU] - yloV''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • BKE15840 ([gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|yloV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATAGACAATCCTACTCCTC, downstream forward: _UP4_TAGAAGGGCAATTTGCCCTT
  • BKK15840 ([gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|yloV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATAGACAATCCTACTCCTC, downstream forward: _UP4_TAGAAGGGCAATTTGCCCTT
  • References

  • 22383849,17981983,22517742,28579978,30429218